profile-img
Anjali gupta Asked a Question
June 15, 2021 5:20 pmpts 30 pts
S'ATGCATGCATGCATGCAATrTGCTATATAGCTACACTATAGACATTATATAGAGAGACGAGATATATATATGCcGCG ACAGAGACAGACAGACAGAGAGAGTATATAGAGCACACA3 1) Design forward and reverse primer for a bove mentianed DNA sequence. 2) Determine Tm of both Farward and reverse primer. 3) What would be the annealing temperature for such primer pair in a PCR?
  • 1 Answer(s)
  • 0 Likes
  • 1 Comments
  • Shares
  • Abhijeet Gaurav thankyou
    Forward Primer :- ATGCATGCATGC Reverse Primer :- TGTGTGCTCTAT (nA+nT)*2+(nG+nC)*4 = Tm Forward Primer = 36°C Reverse Primer = 34°C Annealing Temp would be Lower than Tm that is ...
    Show more
    Likes(1) Reply(0)
Head Office :
MPA 44, 2nd floor, Rangbari Main Road,
Mahaveer Nagar II, Kota (Raj.) – 324005

Corporate Office:
212, F-1, 2nd Floor, Evershine Tower,
Amrapali Marg,
Vaishali Nagar, Jaipur (Raj.) – 302021

Mail: info@eduncle.com
All Rights Reserved © Eduncle.com